Updating

I understand that there is not a work tree in a Bayer GIT repo, which means that adding, commit, position, etc. is not possible. is. But why should not this happen? If you have a remote company that is a true repo then I understand that it can not be worked directly in, but in fact it would be more flexibility to make it non-bare, why not? According to the and to start with git 1.7.0, allow a remote push For, the git repository should be bare.

I have GSP that will be sung from a FizzController , but it has JavaScript code which needs it To send AJAX calls back to BuzzController . My current project directory structure: myapp / grails-app controller / myapp / FizzController Groovy BuzzController.groovy Ideas / Fiz / Menpage. Gsp buzz / buzz.gsp & Lt; General grails-app dir> General directory structure for Grails app src / web-app / & lt; & Gt; GSP: DIF index () {render (see: "discussion") to FizzController # index method when I Run it and go to http: // localhost: 8080 / myapp / fizz , I hope it presents it to my GSP. Instead I'm getting a custom "Page Not Found" page. Nothing in the Application log Any ideas about what's happening here? render is not the parameter parameter controller Then you need to use something like this: Render view: '/ buzz / buzz', model: fetchAndInjectModel () Docs : Other options do a redirect: Redirect (Cont...

मेरे पास अगला कोड है: ArrayList मान = नया ArrayList & lt; Integer & gt; (); // 1 value.add ("टेस्ट"); // 2 मैं 2 लाइन समझने की कोशिश कर रहा हूँ। हालांकि मुझे लगता है कि value.add ("test") देख सकते हैं; त्रुटियों के बिना संकलित, मैं कर सकता हूँ यह देखने का कारण नहीं है कि यह एक रनटाइम अपवाद फेंकता नहीं है यदि मान एक सामान्य ArrayList ऑब्जेक्ट को संदर्भित कर रहा है, तो क्यों जावा इसे स्ट्रिंग जोड़ने की अनुमति देता है? क्या कोई मुझे इसकी व्याख्या कर सकता है? मुझे इसके बारे में सबसे करीब की व्याख्या मिली है, लेकिन मुझे मुख्य कारण समझ में नहीं आता है: स्टैक s = नया स्टैक & lt; Integer & gt; () यह एक पैरामीलेटेड प्रकार से एक कच्चा प्रकार के लिए एक कानूनी रूपांतरण है। आप किसी भी प्रकार के मूल्य को पुश करने में सक्षम होंगे। हालांकि, किसी भी ऐसे ऑपरेशन के परिणामस्वरूप "अनियंत्रित कॉल" चेतावनी पड़ेगी। सामान्य प्रकार रहे । तो रनटाइम पर, एक ArrayList एक कच्चा ArrayList है, चाहे आप इसे सामान्य या नहीं के रूप में परि...

I made an indicator using the denormalization concept The problem is that when I manually index items, So it is indexing objects, while it is not able to index when I'm trying to index items from cron.php using cron run. For example, if I have 56 users then indexing is being manually indexed and showing that "All item are index (56/56)" while when I cron Using cron run from php, it is showing as "all items are index (0/0)". And when I am writing a custom cron in my module, it is doing well, i.e. the objects have been correctly indexed

I have the following status entries in a table come from the list of users for a specific ID. In this way there are 3 rows in ID 7, say, 2, 6, 7 (these three are the unique IDs for the user data table). The table looks like this to clarify. ID USERID keyboard where the key is auto_inc and is the primary key of the table. These entries come from a multiple selection field. Users may want to delete user 2 and add user 8. Therefore, the function requires updating the table, array 8,6,7 for ID 7. As soon as I can get to synchronization, it is to delete every entry, add 3 new entries in the table for ID 7 and in the table (7, 8) (7, 6) (7, 7). Although I do not know that this is what it is supposed to be. Is there a better way? Apart from this, the key to this method actually runs fast (basically, for each modification in the table). Is this the problem? I am a newbie with these things, so please be patient. OK, you can delete selected rows like this: my_table where th...

I am trying to use Giga-SDK to login to the app through Facebook. The setup on Facebook looks good and the original FaceBookbook login works well without the Giga. But when I make a call that completes the Griz Method after successful login to Facebook - the website is never called. This is my very simple code: IOS SDK: 8.1 FaceBox-SDK: 3.20 Giga-SDK: 3.0.6 There are some things you need to check: In the Giga console for the use of the API key Your permission settings You need to make sure that you have the permission to "Enable desktop / mobile usage" as being enabled for the API key to be used. The Facebook Provider Configuration Settings in the Giga console for the use of the API key. Gigya provider will select Facebook API v1 by default in configuration; If your Facebook social network app is new, then it will use API v2 You need to make sure that you have chosen the right settings. If you are using a CNAME, you must ensure that the CNAME CNA...

I am trying to create a model in which a question is in front of the tortoise. Each turtle represents a unique domain of knowledge (1, 2, 3, 4, 5 ...) and in each question there is a random subset of the domain, e.g., (3 5 8). Then I want to ask the turtle with the IDs that are included in the answer to the question. I'm hoping to get some advice on this: How to create a random array for the question (global variable) and; Ways to Compare against Turtle ID This is my first time using NetLogo, so I apologize for the ignorance. And I'm definitely not requesting you to do this work for me, but how do I use some advice / orders in the right direction? 2. For comparison, I have written the following but I am sure this will work. My concern is that if he is looking for an exact match of the query array with the kurtl id, then a match will never be found. What is my intention, if a turtle id is anywhere in the array, then [set the expert? 2]: To answer an answer Aga...

How to add a delete button to remove it completely in MySQL DB. Below is the code and how can I delete the row using the id that is the primary key .. & Lt; Td & gt; $ Line ['first name']. '& Lt; / TD & gt; & Lt; Td> '. $ Line ['last name'] '& lt; / Td> & Lt; Td> $ Line ['email']. '& Lt; / TD & gt; & Lt; Td> '. $ Line ['mobile'] '& lt; / Td> & Lt; Td & gt; $ Line ['gender']. '& Lt; / TD & gt; & Lt; Td> & Lt; A href = "" & gt; Remove & lt; / A & gt; & Amp; Emsp; & Lt; / TD & gt; & Lt; / TR & gt; '; } Echo '& lt; / Table & gt; '; ? & Gt; Link your deleted anchor to new page & lt; A href = "delete.php? Id = '. $ Line [' id ']." & Gt; Remove & lt; / A & gt; and at delete.php if (! ($ _ GET ['id'])) {$ id =...

Currently I have a method in my BaseController and I need the user in each controller method Being authenticated I always leave this piece of code with the call: User, err: = c.getUser () If mistake! = Zero {return c.Redirect (UserController.Login)} which just checks strong. Interrupt Methi ((* User Controller). Check-on, Revert.backup) (in Init.go) .RenderArgs ["user"] . has added a valid user. Anyways, I can put this redirect in the login page. Matthew checks in a filter / intercept method, so I do not have to repeat the above code 10 times? (I have developed this code around v0.9 ~ 0.10) A solution I came up with would be to insert a module / app just like a new CSRF module. Edit on 4.11.2015: This question was posted some time ago, please look back to the official, because there is a lot of development Do not just request your controllers unless the authentication is done properly. You have to implement one for this. This means that init....

I want a world map color with the color obtained in excel trough conditional formatting. This process is free, but I need the HTML code of colors for every cell (there are 229 cells in it, so that the Manual Solutions table has been discontinued) The trough of color is a conditional formatting rule of many cells. The problem is that the all the solutions that I found online only work for cells that are not "conditionally formatted" . Their full color was set manually The file I am using to automatically map the map can be found here: Such a solution that works for conditional formatted cells Will come back and the result of the HTML color code will be ideal: Thanks in advance for any help

I created a NSMutableArray to store some letters there. When I'am add some character it gives me an error here My code: @property (strong, nonatomic) NSMutableArray * functions; & Lt; Synchronize the actions of ViewController.h; & Lt; ViewController.m Action = [[NSMUTABELARROL] INIT]; Switch ([sender tag]) {case 0: currentLabel = water; [Enter objects: @ "0" on index: i]; I ++; break; Case 1: Current Label = Coke; [Enter the objects Object: @ "1" at index: i]; I ++; break; Case 2: Current Labels = Imagery; [Enter objects: @ "2" andx: ii]; I ++; break; } [Actions addObject: @ "X"] / Code> Instead of if there is no element in the array, then you can not put the pointer on object 1.

I want to group some controls of a model with a template (can not be hardcoded in C #) . If there are some changes on the layout, I can edit the template's html instead of converting it to each view. It is what I have done so far: View & lt; Section square = "pure-living" & gt; @foreach (kwwalpere & lt; string, object & gt; item view) {if (vedata.model metadata properties) any (x = & gt; x property name == item.key)) {& lt; Div class = "pure-u-1 -2" & gt; @html Label (item) @html Editor (item) @html Validity message (item) & lt; / Div & gt; }} & Lt; / Section & gt; And I am using this template: @ Html.EditorFor (model = & gt; model, "InputBlock", new {model} First name, Model.LastName, Model.LastLogin, Model.Id}} This works, it underlines all the controls because they should be with the right type. The problem is that any features added in a model such as [urgent] or [DisplayName...

I have created a page with some layouts with CSS :) The problem is that the section area is overlapping the header area Is ... :) How to solve this? The header area should be at the top, and then the section area should be displayed HTML code: & lt; Header style = "width: auto, outline: 1 px solid red, position: relative;" & gt; & Lt; Div style = "width: 150px; outline: 1 px solid green;" & Gt; XXXXX picture xxxxx picture xxxxx image & lt; / Div & gt; & Lt; Div style = "width: 810px; height: 70px; outline: 1 px solid yellow" & gt; & Lt; Div style = 'position: relative; Width: Auto; Height: 100%; Profile: 1px solid red; '& Gt; & Lt; Div style = "position: full; top: 50%; height: 20px; width: 100%; margin-top: -10px; outline: 1 px solid green;" & Gt; & Lt; Div style = "float: left; padding: 0 20;" Class = "blue" & gt; News & lt; / Div & gt; & ...

I am creating an application in my spare time for some time and about protecting my product I am thinking of stealing (this will be something that the customer will be on his server). I am looking at various encryption products and they do the trick. But how much will I slow down my site? It is not possible to currently run encrypted general programs on client machines ( on this What do you mean, is code obscission that is by no means not encryption. Most likely when there is no performance hit, when you use it the same way Just as javascript runs in the same way when minified.

जब मैं कोशिश करता हूं और उदाहरण चलाता हूँ var FancyCheckbox = React.createClass ({rendere : फ़ंक्शन () {var {checked, ... other} = this.props; var fancyClass = checked? 'FancyChecked': 'FancyUnchecked'; // `अन्य` में {onClick: console.log} है, लेकिन चेक की गई संपत्ति नहीं है वापसी (& lt; div {... अन्य} className = {fancyClass} / & gt;);}}); प्रतिक्रिया.रेडर (& lt; फैंसीकैकबॉक्स चेक किया गया = {सच} ऑनक्लिक = {console.log} & gt; हैलो वर्ल्ड! & Lt; / FancyCheckbox & gt ;, document.body); मुझे अनचाहे सिंटेक्स त्रुटि मिलती है: अप्रत्याशित टोकन { । इस सुविधा का उपयोग करने के लिए आपके पास होना चाहिए दुर्भाग्य से आप प्रयोग कर रहे बेला एकीकरण को सक्षम नहीं कर रहे हैं। एक ऐसा है जो इसे जोड़ता है, इसलिए यह बहुत संभावना है कि वहाँ ऊपर होगा। यदि आप इसे तुरंत उपयोग करना चाहते हैं, तो आप या तो फाइल की मेजबानी कर सकते हैं या बस सीधे बेला को स्क्रिप्ट जोड़ सकते हैं: & lt; script & gt; (Function () {var टैग = document.querySelector...

defines a named variable as scary which is an indicator for a function Which gives an indicator to double the arguments of a single type pointer and reduce it? Is that correct? Small * (* scary) (double *) Should googled for " function pointer c " in the first place, but I take your question as a confirmation that you have already studied already . Yes, that's right, do the following as an example: small global = 2; Small * ptr_to_global = & amp; Global; Small * scary_fun (double * ptr) {return ptr_to_global; } Int main (zero) {double val = 22.0; Double * ptr_to_val = & amp; Val; Small * (* scary) (double *); Horror = & amp; Scary_fun; Printf ("% d", * (scary (ptr_to_val)); // print "2" return 0; }

I have found a mobile website that has a navigation menu that is displayed at the top right click of a certain status button. This menu is also fixed so that the menu is below 10px below the top button. The problem is that this navigation menu may be higher than the device used, and when you try and scroll, this content will scroll behind the navigation menu because it's okay. Can somebody help me out? According to my comment: You can search for the upper part of the screen Use JS, set the maximum height of the menu above the menu and the difference between $ ('window') for the height of the window use. For the distance of the menu from the top of the browser: $ ('. Menu') offset () The menu should stay in the event listener: var maxHeight = $ (window) .height () - $ ('. Menu') Offset (); $ ('. Menu') Css ({"max-height": maxHeight}) Make sure overflow: scroll; Click your menu

I am using simpy 3.xx with dragon 2.7. I am trying to create a train simulation why it is necessary that the train process requested a request to enter simulation at a specific time. It should be very easy to do this, but I think I can not find any solution. We say simulation-time 20 I want the process of preparing a request event, how do I do it? Common would generate I have a request: req = res.request (), and then req produce I would like to schedule a request event at a specific time. You should start with a timeout event. It generates a timeout event, based on stated, this generates a request event on 20 #at time 20 imports a request event simpy square Trainstation on :. Def __init __ (self, env): self.env = env self .request_event = env.event () self.request_receiver_process = env.process (self.receive_request ()) self.request_producer_process = env.process (self.produce_request () ) def Produce_request (self): yield self.env.timeout (20) self.request_event.succee...

Tell us that I want to design a website with four slides. I want every slide to cover the previous slide, while the visitor is scrolling. There is an attempt with the following stellar.js (a jquery plugin): You can see that it works for the first slide, which is covered by another Goes, but I could not work for others. HTML: & lt; Body & gt; & Lt; Div id = "one" data-stellar-proportion = ".2" & gt; & Lt; P & gt; This is the first div. & Lt; / P & gt; & Lt; / Div & gt; & Lt; Div id = "two" data-stellar ratio = "1" & gt; & Lt; P & gt; This is second. & Lt; / P & gt; & Lt; / Div & gt; & Lt; Div id = "three" & gt; & Lt; P & gt; The third one! & Lt; / P & gt; & Lt; / Div & gt; & Lt; Div id = "four" & gt; & Lt; P & gt; Fourth and final & Lt; / P & gt; & Lt; / Div & gt; & Lt; / Bod...

I was trying to answer a question for someone else and I ran from jquery to strange / unexpected behavior . The width specified in rule 18 in JSFiddle, if I change it to 100% (for example, the method of 200px, then change it to 100%, see what I'm talking about). I should be 100% so that the button automatically fits the text. . The question is: "How do I work in animation 100% width ???" Jquery code: $ (document) .ready ($ ("(ScrollDownArrow") ($ ("(ScrollDownArrow") ($ ("(ScrollDownArrow"). Haclass ("Clicked")) {$ (".im signal image") .Fedote (500) ; $ (". Indicator"). Delay (500) / * Wait Fadeout * /. At Atom ({width: 200} / * Unfortunately the width does not seem to work: 100% So I assumed a px: ( * /, 1000). Permission ({Opacity: 1}, 500); $ (". ScrollDownArrow"). RemoveClass ("clicked");} and {$ (". Sign.") ({Width: 0}, 1000); $ ("signal image"), delay (1...

I have a fasta file which looks like (original_reads.fasta) read_identifier : abcdefgh AAGTGTAAAGCCTGGGGTGCCTAATGATCGATCGATCAGGTGTGTGAGTGTGTGTGTGTGTGTGTGAATGGGAGTCCTGCAGCGCACTGTGCCCGACTGAAATTCCGTATCAGAATCTGTTGACTTTCTCCCAGATCGATCGATCAAAAAGGATCTCAAGAAGATCC My Library sequence 37 bp (which begins after an adapter sequence) and Long 96 BPA. After that the remaining 34 base pairs is another adapter sequence. I want to trim 37 bp adapter and 34 bp adapter. The code I tried did not work because the whole sequence is to be sorted in the second round. I used bilateral experiment. Here is my code: Suggest a solution def trim_adaptors (record, adapter):. List or iterator "" "The correct adapter trims, it should be a generator function, record logic. Return to the #cache SeqRecord objects for later record in record" "" len_adaptor = Lane (adapter):. Index = record.seq.find (adapter) if index == -1: #adaptor is not found, then the trim editor will not rec...

Today I came to know that my installer does not uninstall correctly. My app means that the control panel is no longer visible after uninstall, but all the files are still present. I looked at the log files and I am not allowed to uninstall many "components because other clients are present", which means that apac means I clean my system. So what's the best way to clean and stop my PC from being in the future? What could have caused this? The APAIIK did not completely uninstall the previous version of my app due to this error? Unfortunately, the use of VM is not possible due to various reasons. FYI: For the purposes of development and testing, I usually test the installer with 1.0.xxxxx and I create, where xxxxx often remains the same. My upgrade code is always the same, apart from this, I am using heat and wherever possible I allow myself to automatically generate GUIDs, besides I have a CA, after my installation, remade files and execution of a batch file To mo...

I was wondering if it is possible to create dynamic ARA, i.e., arrays with code based on user input If the user enters 3 , the code creates three arrays or if the user enters 5 , the code creates five arrays on how I can do it Any ideas? print 'how many arrays? '# = & Gt; It looks like 5 has entered arrays = Array.new (gets.to_i) {[]} # = & gt; [[], [], [], [], [], []] It will create an array holding 5 different arrays. If you want to store each one in a different variable, then you can use the fact that Ruby allows you to dynamically create example variables: print 'how many arrays ? 'Number = is found. TOII number. Times.each | I #If the number is 5, then I have 0,1,2,3,4 examples_with_set (: "@ array_ # {i}", array.New) end p @ array_0, @ array_1, @ array_2, @ array_3, @ array_4 Assume that we have entered 3 here, the first 3 example variables ( array_0 via array_3 ) will print [] , while Previous 2 prints zero (because they ...

Is there a way to get a meeting-created and meeting-modified event through EWS in MS Exchange 2013? ? I am very new to EWS Many thanks! EWS does not have such incidents as you have an ASCIC notification, so that you can do something new The item is created in the calendar folder or when an item is modified, get the notification if you want a push type notification, then three different types of notifications are pushing, pulling and streaming, then the streaming notification is generally more See information Area is the best place. Cheers Glenn

Every time I try to update the icon's badge when push notification arrives and when I click on that icon Which I want is a message of notification I tried to use a local notification in "ApplicationDidReceiveRemoteNotifications" for the badge: UILocalNotification * setBadge = [[UILocalNotification alloc] init]; UIApplication * app = [UIApplication shared application]; SetBadge.timeZone = [NSTimeZone default timezone]; // When a notification set is set, update the app badge. IconBadgeNumber + = 1; SetBadge.fireDate = [Date of NSDT is not intermediate between current: 2]; [App Schedule Local Notification: Setbase]; and [UIApplication ShareApp] .applicationIconBadgeNumber + = 1; None of them work. "Text"> This works fine in my project: - (zero) Application FeedbackActive: (UIApplication *) application {// any work was stopped which (Or did not start), while the application was inactive if the application was previously in the ba...

I am using and allow me to use it over the root. I have set up ServiceStack CorsFeature in my application, but it is not honored by ServerEventsFeature . I can manually add the app-control-permission-origin heading to added , and request that the event- Stream , but the request for heartbeat fails because I can not set the header on this request. plugins.ed (new server eventfeature {heartbeat interface = new timepace (0,0,30) on crated = (subscription, request) => ; SSE functionality as I request.Response.AddHeader ("Access-control-permission-origin", "*");} ...} , I can not see that How to get this header in the request. Is there a way that I can set the header for all / event - url? Thanks. / P> Only / event-stream and / event-heartbeat are raw HTTP handlers, other events - * route common service stacks The service stack requests are through the pipeline. I have automatically created the Config.GlobalResponseHeaders / Ev...

I am using the UI-selection of an EngineeringUse to create multiple multisllects on one page. When the user clicks a button on the page then I need to be able to open the dropdown list. I have tried to use jQuery's .click () and . Toggle element ('click') , but in these results $ is already in progress error when called by the button's ng-click function Although they call from the console of Chrome, the task in ng-click does nothing other than simulating the second click. . Focus () does nothing input. I also reluctantly tried a dirty hack, where I use the selector's ng-init to reach a controller in a radius, in which the access to the button , And then the controller toggle () and active () methods it has focused on input, but the associated dropdown list should not be open. How can I toggle the dropdown manually outside the context of the UI-selection element? I have tried and instructions can be obtained by the method. Working ...

इस सवाल का पहले से ही एक उत्तर है: 6 जवाब सार्वजनिक वर्ग ए {} // 1. लगता है कि टेस्ट निश्चित रूप से एक सिंगलटन है, यहां सिंगलटन डीफॉल्ट असफल छोड़ें // 2. टेस्ट फ़ील्ड ए (क्लास ए) में कोई गंदा मूल्य समस्या नहीं है, या क्या यह है? // 3. सिंगलटन ऑब्जेक्ट (पूर्व, यह नमूना) फ़ील्ड असाइनमेंट (बहु-थ्रेडेड परिवेश में) में कोई रेस की स्थिति या डेडलॉक इश्यू नहीं है, या क्या? सार्वजनिक कक्षा परीक्षण {निजी ए एक; सार्वजनिक ए () (यदि (ए == रिक्त) {a = नया ए (); } वापसी; }} आपका कोड धागा सुरक्षित नहीं है। मान लीजिए थ्रेड 1 नामक test.get () थ्रेड 1 प्राप्त करें () विधि की जांच की गई (एक == रिक्त) -> जो सही है --- परन्तु संदर्भ स्विच --- --- थ्रेड 2 को test.get () थ्रेड 2 प्राप्त करें () विधि की जांच की गई (एक == रिक्त) -> जो सच है थ्रेड 2 मिल () विधि एक ए 1 ऑब्जेक्ट बनाता है और इसे किसी को निर्दिष्ट करती है; थ्रेड 2 मिल () मेरिट रिटर्न A1 --- Context switch यहाँ थ्रेड 1 मिल () विधि एक ए 2 ऑब्जेक्ट बनाता है और इसे किसी को निर्दिष्ट करती है; थ्रेड...

While working on a polymer website, I wanted to contain most of the functionality required for ESOS's dojo-based map component I used the code again as a polymer component I tried to create an element using the code given below, but the map constructor throws an error because it can not be found with the 'map' ID & lt; Link rel = "stylesheet" href = "http://js.arcgis.com/3.11/esri/css/esri.css" & gt; & Lt; Link rel = "stylesheet" href = "http://js.arcgis.com/3.7/js/dojo/dijit/themes/claro/claro.css" & gt; & Lt; Polymer-element name = "esri-map" & gt; & Lt; Templates & gt; & Lt; Style & gt; #map {height: 100%; Width: 100%; Margin: 0; Padding: 0; Background color: wheat; } & Lt; / Style & gt; & Lt; Div id = "map" render = "" & gt; & Lt; / Div & gt; & Lt; / Template & gt; & Lt; Script src = "http://js.arcgis.com/3.11/...

'ello, I am a student in college, I am studying computing. I am currently working my course (which insists on creating a database) and I was hoping that you can clear some things for me Side-Note: Programming is not specific. 1) Can you use wire as a primary key i.e username? 2) Should the primary key be "id" in their name? 3) If you use the name as the primary key, will you be able to use the verification technique to ensure that each name is unique? I have done most of my research at present that I can use the names as a primary key and verification to make sure that they are unique, because an example database that we researched The same principle was made earlier, however, my teacher (a new teacher) is telling me that I need to do my work again and I try to get out of doing everything again And am I, because I have consulted my learning resources and can not find any reason for not being able to use to use integer primary key or verification for any reason. ...

I am told: Write a function named start_codon Which accepts a DNA sequence as its logic and gives the first coding as a string. Here's what I've done so far: #! / Usr / bin / python def start_codon (DNA): codon1 = dna [0: 3] Codonstring = codon1.split (","); However, when I try the function and press enter to call, I get a syntax error: file "& lt; stdin & gt;", line 1 print (start_codon ("ATGGAACACAACGTCAGTGACTTCGTCAG")) You are distorted by either quotation marks " ... " or apostrophes '...' : should use print (start_codon ("ATGGAACACAACGTCAGTGACTTCGTCAG")) # or print (start_codon ('ATGG AACCAACGTCAGTGACTTCGTCAG ')) " and " are special characters that are not recognized by Python.

I am creating a custom vimrc to improve my workflow, and set me a centralized directory to keep everyone Like backing up, swaping, and rearranging files together, like: "=== Backup settings ===" Set up back up set up backupdir = ~ / .vim / backup // "== = swap files ===" set swap file set directory => / swap files on /vim / swap // "=== UNFO FI === "Turn the undoFile on the undifil set to set the undodir = ~ / .vim / undo // The double trailing slash is considered as a file name extension, whose As a result, the backup / swap / undo filename will be the absolute path, in which % will be replaced by each location, / , something like % home% username% path% to% Your% file.ext . Everything works perfectly for swap and undo files, but the backups do not work, the complete path to the file names is file.ext ~ , which means that when I edit two files in the same way Does anyone have any clue about this problem? It looks like the 'b...

I have very little trouble updating table cells in the table: One of my cells Updating after clicking on the button (the data is sent to DB, after updating the IB after receiving the value from DB) everything is working fine, but: rows.push (qx.lang.Object.getValues ​​data [i])); TableDM.setData (rows); After that, the table is resetting its settings, for example if one of my columns is moved after resetting it to the default value. Is there any possibility of closing that reset? Maybe everything just happens in another way? If you use the qx.ui.table model Simple setdata method has a second boolean parameter cleanening . rows.push (qx.lang.Object.getValues ​​(data [i])); TableDM.setData (rows, incorrect);

I use the $ entry function from GWT in my JSNI function. I use them in most of two cases: When I create a new object in JSNi create public static basic KGroup () / * - {var create = $ entry (function () {new $ wnd return.Kinetic.Group ();}); Make a comeback; } - * /; Whenever I make an event handler somewhere create a public static original last KenodeEventCollbacks (KenodeEventCollbackbackback)) / * - {var t = $ Entry (function) {callback com.test.KNodeEventCallback :: onEvent (....) (Event);}); Return T; } - * /; Does this slow down my application? Because anytime I use this GWT will add an attempt to hold the javascript function in the block. Is there a rule of thumb when using $ entry and not?

I have a search query that works fine (I've stripped some unimportant code): $ post = new post; If you are looking for posts with the title (input :: is ('query')) or // $ posts = $ posts matching the given criteria - & gt; Add (DB :: Raw ("Matte (posts.title) AGAINST (()) -> where (function ($ query) {return $ query - & gt;); - & gt; addSelect (DB :: Raw (as "MATCH (tags.title) AGAINST (?) Tag_score") where 'R' (Against posts.title)? - & gt; or Warred ('matte' (tag. (?) ');} -> Order By (DB :: Raw (' Post_score + tag_score ',' Desc ') -> Set bonding ([$ input [' query '] , $ Input ['query'], $ input ['query'], $ input ['query']]);} But as soon as I am above the if () Add this piece of code before the statement: if (in the input :: ('filter')) {$ posts = $ posts-> where type ( $ Input ['filter']); // filter 'either' question ...

My app is trying to download json data from the BE and save it on the core data. To keep track of downloading the remaining data contents, I save them in key data too. When the data says that data is downloaded in batches of 10, then I will remove the data ID downloaded from the core data object. It works fine when it goes in the background if the app data is killed during the download, then the app resumes when the app is activated, though after downloading, I do not have data ID downloaded from NSManagedObjectContext Can delete I have attached the code below: - (minus) removeIdListAtIndexesCustomized: (NSIndexSet *) index {NSMutableOrderedSet * IdListMutable = [self mutableOrderedSetValueForKey: @ "IdList"]; [Index Enumerate Indexing Lock: ^ (NSUnterger IDX, Ball * Stop) {[NSManned Object ContactDialAbject: [IDListMptic ObjectItindex: IDX]]; // this is where the program stops) ;; NSError * error; If (! [Ansmanedobjekt save contact: End Edition]) {Anselog (@ "sav...

It is in the form of a word, we say that I have been given the string "foo", and my array Words like "food", "fool", "fu" inside should be printed out of three. I have not made a concert effort yet because I do not know how to wrap my head around it. Any ideas? Assume that you are using std :: string If you have a vector of strings, you can use it (for example) with string :: find Can be used. > Std :: remove_copy_if to print all the words from the vector in which the chosen words are: #include results: food waste foo tofoo

I have a fairly standard spring boot app, we are in the stage of the demonstration of application testing. To do this, we have to prepare a large set of requested objects from a funny library. The end point uses protobufs, so they should be thrown into a file and saved for Jmeter. I would like to add some type of command line functionality to my application so that it can only generate performance test assets. I have tried such things: java -cp targets / sm-reports-1.0.0-SNAPSHOT.jar com.blah.reportservice.AssetGenerator or Java-Dloader.main = com Blah.reportservice..AssetGenerator -jar target / sm-reports-1.0.0-SNAPSHOT.jar Optionally keeping the functionality in the main category None of these is going to work. Due to the architecture of the original project here in the company, a module style approach will be a ton of work. Is there a good way to accomplish this or place? Do I switch on non-attackable configuration before heading to some flag or variable? In an i...

I am trying to set an int, which is defined in class, after 0 to 5 seconds Has been replaced by more than 0.. Any help will be very much appreciated! I have a program where users have to input an additional input for the score. Private zero input response (patient) = patient P = faucet; P = patientlist.GATE (PNIM); Maps & lt; String, list & lt; Double & gt; & Gt; PData = sEWSTracker.get (P); & Lt; Double & gt; Sep = pData.get ("SEW"); Double SEVs = sEp.get (SEP. (Size) - 1); Component frame = null; Object [] response = {"alert", "verbal", "pain", "unresponsive"}; String R = (string) joppenpan. Shownput Dialogue (frame, "Initiate the patient's reaction External stimuli: \ n", "Please report the reaction level of the patient", joppenpane.PLIN_MACSage, blank, reaction, reaction [0] ); Int reACT = 0; If (r.equals ("verbal")) {if (pNum == 0) {p0checked = 1; } If (pNum == 1) {...

मेरे पास QTabWidget है, कि एक विशेष टैब पर QTableView उपवर्ग और QHBoxLayout का QPushButtons (डालें, हटाएं, भरें / कैल्क, कॉपी, पेस्ट करें)। लाल हलकों से पता चलता है कि जब भी मैं QTableView में एक चयन करता हूं, सम्मिलित करें बटन भी चयन का लाभ उठाता है परिणामस्वरूप, जब सेगमेंट नाम लाइन में उपयोगकर्ता प्रकार और हिट दर्ज करें (परिवर्तन जमा करने के लिए), परिवर्तन सबमिट किए गए हैं और डालें बटन सक्रिय है । मैं क्या कर सकता हूं QTableView सेल्स और सम्मिलित करें बटन चयन के लिए परस्पर अनन्य हैं? दूसरे शब्दों में, जब उपयोगकर्ता किसी मेज सेल पर क्लिक करता है तो मुझे कोई बटन नहीं चाहिए ऐसा लगता है कि आपका बटन डिफ़ॉल्ट है। इसे गलत पर बदलें। ui- & gt; insertButton- & gt; सेटडिफ़ॉल्ट (गलत);

I wrote a grammar in ANTLRWorks 1.5.2. I have also added some functions, when I debug my code for a while, it will show 3 address codes in the output of ANLRWorks. My grammar is like this: name: letter (letter | digit | '_') *; Number: DIGIT +; // just the integer piece points: '0' .. '9'; Piece Letter: 'A' .. 'Z' | 'One' .. 'z'; Relation: '& lt;' | '& Lt; = '| '==' | '& Gt; = '| '& Gt;' | '! = '; WHITESPACE: ('' '' '\ t' | '\ r' | '' \ n ') + {$ channel = HIDDEN; }; And I generate my grammar and I have that while in Parser.cs and whileLexer.cs in the Output folder. Now I want to add my grammar to a C # project. I want to get input from the user and then show them my grammar product. And I do not know how to add .g file and output class in C # project. I am using Visual Studio 2013 Can anyone help me? You have...

I need to retrieve the new points of my polygon (inside the canvas) after a rotate transform. Rotate Transformation Rotation = New Rotate Transform (Rotationangle); Polygon Reader Transform = Rotation; As the rendererforms are applied, polygon The point collection does not get new values. I have read about people trying to bind it to numeral collection (which is not ObsavableCollection ), but nothing useful to me met. You can see the gradual form of converting all the points in the points collection of polygon You can get changed points from: using System.Linq; Var Converted Points = Polygon Points Selection (P => Rotation. Transform (P));

Then I have a program that I kept in VB for my company via the Visual Studio 2013 Express for Desktop I have not worked and in some months when I try to open it, I get the following error: "VB Project" windows applications 1 "to" NetFramework, version = 4.5 "that is not installed on this machine." I have all the .NET infrastructure installed, including all developers and service packs (even language packs). I uninstalled all the .NET frameworks and restored each of them without any resolution. I tried to install Visual Studio again and even tried to change the framework (I have an option from), but I can not see if I do this Any code or open designer view () The strange thing is that this computer is the same which I have been developing this application for months, so I'm not sure what happened in the last 60 days since I started it . Does anyone have such a clue that how can I solve this issue? Thank you in advance, Matt The pa...

I know this question has been asked, but the methods are not working for me. I have a visual controller in which Includes a tutorial which I want to display as an initial scene for the first time when I open the app. After that, the main menu will always be the initial scene. The Storyboard ID "Tutorial" for my tutorial screen has the following code to find the first launch, but I did not know how to show the tutorial: - (zero) ViewDidload {if ([[NSUserDefaults standardUserDefaults] boolForKey: @ "First launch"] {} Other {[NSUserDefaults Standard User Defaults] Setbool: Yes for Y: @ "First Launch"]; [[NSUserDefaults Standard User Defaults] Synchronize]; You can change the initial controller in two ways: Check the 'Initial VC' checkbox in the interface builder or configure it -Application: The Finnish Launching Destination: Method Change the initial view controller by using the application In-app: In-application: done Finnis...

Either way I- A where an x ​​is supposed to close the window. Would anyone tell me that I should find this wrong type or error where it was bootstrap or jQuery ... is it really annoying when I rest it in a bella, it shows an x ​​again. Does anybody have any ideas, where can I be able to detect this problem? I am using: jQuery-1.11.1, (with lubricity ui) Bootstrap 3.2.0, (with min.css) As you see that I had placed here an x: (This is the reason I think this is either behind the scenes with either jQuery or Bootstrap) & lt; Div class = "modal fade" id = "modal_special" tabindex = "- 1" role = "dialog" area-labeling = "meridial label" axia-hidden = "true" & gt; & Lt; Div class = "modal-dialog" & gt; & Lt; Div class = "modal-content" & gt; & Lt; Div class = "modal-header" & gt; & Lt; Button type = "button" class = "off" data-discard...

निम्नलिखित HTML टुकड़े पर विचार करें: & lt; div class = "text-center" & gt; & Lt; h3 & gt; लाइक: & lt; span class = "मोनोस्पेस" & gt; & lt; मजबूत & gt; {{Laeq | Paddednumber: 7: 2}} & lt; / strong & gt; & lt; / span & gt; डीबी & lt; / h3 & gt; & Lt; / div & gt; जहां paddednumber एक फ़िल्टर है जो प्रमुख स्थानों को जोड़ता है: myFilters.filter ('paddednumber', function () { रिटर्न फ़ंक्शन (मान, चौड़ाई, दशमलव) {यदि (मान === अपरिभाषित) रिटर्न; var परिणाम = वैल्यू। फिक्स (दशमलव); जबकि (परिणाम। लम्बाई & lt; चौड़ाई) {परिणाम = '' + परिणाम;}; वापसी परिणाम; }; }); मैं फिल्टर को जोड़ा गया प्रमुख स्थानों को ट्रिम करने से कैसे कोने से रोक सकता हूं? मैंने textarea और इनपुट निर्देशों के लिए एनजी-ट्रिम विकल्प पाया है, लेकिन ऊपर दिए गए नमूने में Laeq एक $ संसाधन के लिए बाध्य है और फ़ॉर्मेटिंग अधिकार प्राप्त करने के लिए फ़िल्टर की आवश्यकता है। मैं निश्चित रूप से नियंत्रक म...

I want to ask what should be in the body element of the SOAP request. I would think that this should be an element defining the name of an operation, which I want, I would also agree that inside this element there should be a structure related to the input parameters of this operation. However, if I take the following WSDL: and Sophodi generate a request for the GetStatusNespolehlivyPlatce operation, the content of the request will be: & lt; Soapenv: envelope xmlns: soapenv = "http://schemas.xmlsoap.org/soap/envelope/" xmlns: roz = "http: / /adis.mfcr.cz/rozhraniCRPDPH/"> & Lt; Soapenv: header / & gt; & Lt; Soapenv: body & gt; & Lt; Daily: StatusNespolehlivyPlatceRequest & gt; & Lt; Daily: DIC & gt; 00247618 & lt; / Daily: DIC & gt; & Lt; / Daily: StatusNespolehlivyPlatceRequest & gt; & Lt; / Soapenv: Body & gt; & Lt; / Soapenv: envelope & gt; & lt; Soapenv: body & gt; is not t...

I have a table named trips that looks like this: id | Vehicle_id | Start_time | And_time | ---- + ------------ + --------------------- + ---------- ----------- + 1 | 1 | 2014-06-16 22:00:00 | 2014-06-24 03:30:00 | 2 | 1 | 2014-06-24 05:00:00 | 2014-06-28 05:00:00 | 3 | 2 | 2014-06-23 02:00:00 | 2014-06-30 04:00:00 | SQL Fueled: (PG 9.2 only because 9.3 was overloaded on SQL Bedle.) start_time and end_time are both timestamps. I want to search for travels related to the same vehicle_id where a start_time travels the same calendar day or earlier of the journey end_time occurs next calendar day. As an example, the id will return 1 and above 2 because: 2 's start_time is on the same calendar day ( 2014-06-24 ) as 1 ; And is similar in both rows vehicle_id It is quite possible that it is not capable of doing SQL related postgrad functions for any Also, advice, suggestions or hints have been given. The "previous" row can be acc...

What is the way to cache many queries with memcached in PHP? Suppose a page has to present two questions, so do I need to use two different keys and use $ memcache twice? Here's an example: $ Id = $ _POST ["id"]; $ Memcache = new memcache; $ Memcache- & gt; Connect ('local host', 11211) or die ("could not connect"); $ Dbh = New PDO ("mysql: host = $ hostname; dbname = $ databasename", $ username, $ password); $ Dbh- & gt; Set Attribution (PDO :: ATTRRAMOD, PDO :: ERRMODDEXEPEPS); $ Key1 = "{$ id} 1"; $ Key2 = "{$ id} 2"; $ Cache_result = array (); $ Cache_result = $ memcache- & gt; Get ($ key); $ Cache_result2 = array (); $ Cache_result2 = $ memcache- & gt; Get ($ key2); If ($ cache_result || $ cache_result2) {$ rows = $ cache_result; $ Rows 2 = $ cache_result2; } And {$ sql = "call load_thore (?);"; $ User = $ dbh- & gt; Ready ($ sql); $ User- & gt; Bind Value (1, 1, PDO :: param...

I have supported my existing Wordpress site to work at the local level to create a multi-site network. My goal is to not only leave the existing site, but to add a new homepage with my own theme. I am trying to create a multi-site inside a sub-folder. I have got to work with a fresh installation, although I have participated in complications with an existing local site. The steps I have taken: I changed the .htcaccess file to: # BEGIN Wordpress RewriteEngine On RewriteBase / RewriteRule ^ index \ .php $ - [L] # / Add a trailing slash to wp-admin ^ ([_ 0- 9a-zA-Z -] + /)? Wp-admin $ $ 1wp-admin / [R = 301, L] Rewrite code% {REQUEST_FILENAME} -F [OR] REWIND Condom% {REQUEST_FILENAME} -D Rivetrium ^ - [L] Remit Rules ^ ([_ _ 0- 9A -J-A-Z -] + /)? (WP - (content is included in | admin |). *) $ 2 [L] Rev. Raul ^ ([_ 0- 9A-GA-Z +] + /)? (. * .php) $$ 2 [L] Rev. Raul Index.php [L] # END WordPress > Changed from: 8888 & amp; : 8889 to : 80 & amp; nbsp; : 3306 ...

मेरे पास MySql तालिका है जो इस तरह दिखती है quiz_id | User_id | अंक -------- + --------- + -------- 1 | 1 | 2 1 | 1 | 7 3 | 1 | 7 2 | 1 | 5 1 2 | 7 2 | 2 | 7 3 | 2 | 2 3 | 2 | 6 उपयोगकर्ता उच्चतम अंक प्राप्त करने की कोशिश कर रहा खेल को फिर से चला सकता है .. मुझे उपयोगकर्ता द्वारा प्रति क्विज़ में सर्वश्रेष्ठ "अधिकतम" अंक लेने के लिए क्वेरी की ज़रूरत है, और इसे सॉर्ट करें सभी प्रश्नों के योग अंक, और इसे इस तरह देखने के लिए करें: user_id | एसएम (अंक) -------- + -------- 2 | 20 1 | 19 मैंने इसके साथ इसका दूसरा भाग करने की कोशिश की है का चयन करें user_id, SUM (points) से Quiz_list GROUP BY user_id ORDER BY SUM ( अंक) डीईएससी मुझे वाकई बहुत सराहना होगी अगर कोई मुझे दिखा सकता है कि यह कैसे एसक्यूएल क्वेरी के रूप में दिखना चाहिए। मुझे लगता है कि आपको अधिकतम () प्राप्त करने के लिए एक subquery की जरूरत है और फिर sum () : user_id का चयन करें, sumpoints के रूप में sumump (points), user_id (quote_not), quiz_id, quiz_id द्वारा quiz_id समूह के अंक के रूप ...

How is the memory allocated using malloc ()? Who assigns memory to OS or compiler? Once the memory is free using (), then can it be used by other processes? 4 memory areas in the OS HANP, stack, text and data. When you use malloc the OS map provides storage from the area. The compiler is not responsible for allocating this memory. When you use it free, the memory block comes back to the heap.

I want to combine two images together with a ratio of 4: 1 Should be such as then what Any ideas? The question is unclear, but you can use the 2D graphics API // i.stack.imgur.com/YfAyE.jpg "> Try {BufferedImage base = imageIO.read (new file ("base.jpg")); Buzzed Image Overlay = Images Reed (new file ("overlay .jpg")); Graphics2D g2d = base.createGraphics (); G2d.setComposite (AlphaComposite.SrcOver.derive (0.5f)); Int x = (base.getWidth () - overlay.getWidth ()) / 2; Int y = (base.getHeight () - overlay.gethight ()) / 2; G2d.drawImage (overlay, x, y, tap); G2d.dispose (); ImageIO.write (base, "jpg", new file ("blended .jpg")); } Hold (IOException e) {e.printStackTrace (); } results in ... For more information ... / P>

I am using a file opswer to view a folder in Android. When a user modifies or creates a new file in this folder, then FileAbaserver should do some stuff with this file. This is the fact that using the Block Files Observer Modify, every time I create / modify a file in the folder that is viewed, the file observer method (event) is called twice. This is a problem for me because it breaks whatever I do later (this is done twice). This is my code: mFileObserver = new FileObserver (modify directory, file ossever) {public event on event (int event, string filename) {if (event = = File Observer Modifiers) {// do something}}};

I have an interesting multi-processing problem with the structure, which I could be able to exploit. There are several columns and functions with func and a large ~ 80 column dataframe ( df ) which pairs (~ 80 * 79/2 pairs) is in that column in df , and every run takes very little time. The code looks like mgr = manager () ns = mgr.Namespace () ns.df = df Pool = pool (procedures = 16) args = [(ns, list (combo)) Df.column, 2))] result = pool.map (func, args) pool.close () Not fast, but faster than pool, but only one 7 or so factor I'm worried that the upper part of so many calls is an issue. Is there a good way to tap the structure for multi-processing? This is a fairly standard result for setting up each process and overhead for passing data between processes Due to running in parallel, nothing will run exactly the same. Keep in mind that (80 * 79) / 2 = 3,160 is actually a very small number which believes that the function is not very computational inten...

So I surround my SKScene want to make a range of a PNG file that I have a blue border with opacity 0.8 The built edges are clear around and on the inside. Then after adding my background image I added it to my SKCIN. The border goes on top of the background as I want, but when I make a new SKPact node, its image goes to the border rather than its bottom. I tried to install the zposition of the boundary, but to show it is not the reason for any new SKSpriteNodes, even if it is clear inside the border. What I want is to be below the threshold of new SKSpriteNode, they should still give a little show because border opacity of 0.8, and still visible inside the border. Does anyone know what I'm doing wrong or how to correct it? Thank you! What do you say to create 4 images, namely :. Make the height and width according to the lower edge, the right edge, the top and left edge obviously the size that you had given to the scene. After this 4 variables are instantiated and pu...

मैं विशिष्ट खोज शर्तों की तरह कैसे तय कर सकता हूँ: search.date & gt; SomeDate () या search.amount & gt; 0 मैंने कोशिश की है: & lt; a href = "#" एनजी-क्लिक = "खोज। नाम = x> 0" & gt; केवल स्थिति & lt; / a & gt; etc.etc। मेरे पास वर्तमान में एक इनपुट है: & lt; इनपुट प्रकार = "टेक्स्ट" वर्ग = "फॉर्म-कंट्रोल" प्लेसहोल्डर = "सभी खोजें" एनजी -मॉडेल = "खोज" / & gt; यह महान काम करता है और सभी क्षेत्रों को खोजता है यह तब टूट जाता है जब मैं खोज इनपुट में [ऑब्जेक्ट ऑब्जेक्ट] डालकर एक विशिष्ट फ़िल्टर का प्रयास करता हूं। & lt; tr ng-repeat = "किरायेदारों में किरायेदार: फ़िल्टर: खोज | OrderBy: सॉर्ट "& gt; & Lt; td & gt; {{tenant.rent | मुद्रा: "& amp; nbsp;"}}} & lt; / td & gt; & LT; टीडी & gt; {{tenant.name}} & lt; / टीडी & gt; & LT; टीडी & gt; {{tenant.tel}} & lt; / टीडी & gt; & Lt; td & gt; ...

I am using unit framework 7 on night building channel (I currently use version EntityFramework.7.0.0-beta2 I am doing-112524) and I am trying to log the queries generated by the e-mail by curiosity. I am writing a simple console program, I tried to use that EF 6 usage, but DbContext Database The log entity is not available on Framework 7. Is there no way to log on to SQL generated by EF7? For those using EF7, none of the above works for me, but this Like I'm working on it. (From Avi Cherry's comment) In your startup.cs you have a specially configured method with a bunch of configurations near the configured method, it should look like the bottom ( In addition to your content). Configure Public Zero (IAP plugin file builder application, Illogger Factor Logger Factory) {// This Magic Line Logger is Factory.AddDebug (LogLevel.Debug); // Previous LogLevel.Verbose // Your Other Stuff}

Hi Everyone I created a RESTIPAL API with authentication along with Token (Rail 4 + Device), as well as manage the CORS implementation. Mani (rack-cores) but now I want to use encoding with encoding. For this, I do this: var app = angular Module ('model'); App.factory ('session', ['$ resource', work ($ resource) {var session = $ resource ('http://api.creositios.dev/sessions/:id', {}, {create: { Method: 'Post'}, Delete: {Method: 'Delete', Parameters: {ID: 'id'}}}); Return session;}]); And this is my controller app = angular. Module ('controller'); App.controller ('session' Ctrl, ['$ scope', 'session', function ($ scope, session) {$ scope.new_session = function () {$ scope.session = session .create ({email: 'developer Jimenez@gmail.com, password: '12345678'});};}]); So far I have no problem with implementation. My problem is not known how the management is broken, which retur...